circad | circRNAs associated with diseases

hsa_circRNA_104593/hsa_circ_0083964
Gene	ASH2L	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Rheumatoid Arthritis	ICD-10	Rheumatoid arthritis, unspecified (M06.9)
DBLink	Link to database	PMID	28983619
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	Totally twenty RA patients and healthy people age
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCCAGACACATACAAAGATAAGC Reverse GGTATCTGGTGGCATCTCATCC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zheng, F, Yu, X, Huang, J, Dai, Y (2017). Circular RNA expression profiles of peripheral blood mononuclear cells in rheumatoid arthritis patients, based on microarray chip technology. Mol Med Rep, 16, 6:8029-8036.